Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ENTPD1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 953 ectonucleoside triphosphate diphosphohydrolase 1 chr10 + 97466535 - 97472035 97471535 Transcription Factor Binding Sites   Download all TFBS in the ENTPD1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_IRF_Q6_M00772 TRANSFAC + 97474958 97474972 6.0E-06 TCTCCTTTCAATTCT 15 V_ZBTB7B_03_M02826 TRANSFAC + 97472027 97472041 3.0E-06 AAACCCCCATAAACT 15 V_ZBTB4_04_M02929 TRANSFAC - 97474968 97474983 9.0E-06 CAAATACTGACAGAAT 16 V_PAX2_02_M00486 TRANSFAC + 97472034 97472042 5.0E-06 CATAAACTC 9 V_NANOG_02_M01247 TRANSFAC - 97474949 97474968 4.0E-06 TTGAAAGGAGAAAGAGACAA 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.