Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

POM121L2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 94026 POM121 transmembrane nucleoporin-like 2 chr6 - 27279511 - 27285011 27280011 Transcription Factor Binding Sites   Download all TFBS in the POM121L2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 27280633 27280651 2.0E-06 CCGCCAGTAGGTGTCAGTC 19 V_RHOX11_01_M01347 TRANSFAC + 27280882 27280898 4.0E-06 AAGACACTGTTAAGAGA 17 V_MAFB_03_M02879 TRANSFAC - 27280612 27280626 9.0E-06 GATCTGCAAAAAAAG 15 V_IRF_Q6_01_M00972 TRANSFAC - 27280606 27280616 2.0E-06 AAAAGAGAAAC 11 V_RHOX11_02_M01384 TRANSFAC + 27280882 27280898 5.0E-06 AAGACACTGTTAAGAGA 17 V_HMX1_01_M00433 TRANSFAC - 27280720 27280729 8.0E-06 CAAGTGCGAA 10 V_CTCF_02_M01259 TRANSFAC + 27280630 27280649 5.0E-06 ACGCCGCCAGTAGGTGTCAG 20 V_CTCF_01_M01200 TRANSFAC + 27280632 27280651 6.0E-06 GCCGCCAGTAGGTGTCAGTC 20 V_RHOX11_05_M03099 TRANSFAC + 27280882 27280898 5.0E-06 AAGACACTGTTAAGAGA 17 V_SIX4_01_M01374 TRANSFAC - 27280637 27280653 1.0E-06 ATGACTGACACCTACTG 17 V_RHOX11_06_M03100 TRANSFAC + 27280882 27280898 4.0E-06 AAGACACTGTTAAGAGA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.