Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SLC22A6 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 9356 chr11 + 62747495 - 62757495 0 Transcription Factor Binding Sites   Download all TFBS in the SLC22A6 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints REST_MA0138.2 JASPAR - 62747796 62747816 0.0E+00 CCCAGGACCATGGACAGGTCC 21 V_NRSF_Q4_M01028 TRANSFAC + 62747797 62747815 3.0E-06 GACCTGTCCATGGTCCTGG 19 V_MRF2_01_M00454 TRANSFAC - 62747818 62747831 8.0E-06 AAGCACAACACTCA 14 V_REST_01_M01256 TRANSFAC + 62747792 62747813 0.0E+00 TCTGGGACCTGTCCATGGTCCT 22 V_FAC1_01_M00456 TRANSFAC - 62747818 62747831 9.0E-06 AAGCACAACACTCA 14 V_NRSF_01_M00256 TRANSFAC - 62747796 62747816 8.0E-06 CCCAGGACCATGGACAGGTCC 21 V_REST_02_M02256 TRANSFAC - 62747796 62747816 0.0E+00 CCCAGGACCATGGACAGGTCC 21 V_HSF1_Q6_01_M02017 TRANSFAC + 62747786 62747799 6.0E-06 GAGCCTTCTGGGAC 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.