Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

BMP15 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 9210 chrX + 50648734 - 50658734 0 Transcription Factor Binding Sites   Download all TFBS in the BMP15 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints znf143_MA0088.1 JASPAR - 50656584 50656603 9.0E-06 TCCTTTCCACAGTCCCTAGA 20 V_STAT5A_02_M00460 TRANSFAC + 50656654 50656677 6.0E-06 TTCCCTGAAAAGCTTTGACCAGAC 24 V_STAF_02_M00264 TRANSFAC - 50656582 50656602 9.0E-06 CCTTTCCACAGTCCCTAGATA 21 V_TCF7L2_04_M02922 TRANSFAC + 50656619 50656634 7.0E-06 CAGGTTCAATCACACA 16 V_TBX15_02_M01264 TRANSFAC + 50656727 50656744 5.0E-06 TGATGTCAAGGTCTCAAA 18 V_ETS1_B_M00339 TRANSFAC - 50656699 50656713 8.0E-06 GCAGGATGGGGTTGC 15 V_RFX3_04_M02788 TRANSFAC + 50656688 50656710 1.0E-06 TCTGATTCTTAGCAACCCCATCC 23 V_STAT1_Q6_M01823 TRANSFAC - 50656653 50656662 8.0E-06 TTCAGGGAAA 10 V_STAT1_05_M01260 TRANSFAC - 50656644 50656665 2.0E-06 CTTTTCAGGGAAAGGGCTGAAT 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.