Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

GGTLC2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 91227 gamma-glutamyltransferase light chain 2 chr22 + 22983781 - 22989281 22988781 Transcription Factor Binding Sites   Download all TFBS in the GGTLC2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints HSF2_HSF_DBD_trimeric_13_1 SELEX - 22988513 22988525 3.0E-06 TTCTAGAATTTGC 13 HSF1_HSF_full_trimeric_13_1 SELEX - 22988513 22988525 5.0E-06 TTCTAGAATTTGC 13 TEAD1_TEA_full_dimeric_17_1 SELEX + 22988515 22988531 3.0E-06 AAATTCTAGAAATATTT 17 RREB1_MA0073.1 JASPAR - 22992975 22992994 6.0E-06 CACCCACCCACCCGCTGTAG 20 V_BCL6B_03_M02740 TRANSFAC + 22988515 22988530 9.0E-06 AAATTCTAGAAATATT 16 V_HMGIY_Q3_M01010 TRANSFAC + 22988510 22988524 1.0E-05 AGTGCAAATTCTAGA 15 V_ZBTB3_03_M02825 TRANSFAC - 22988502 22988518 1.0E-06 ATTTGCACTGCATGCCT 17 V_HSF2_02_M01244 TRANSFAC + 22988513 22988525 2.0E-06 GCAAATTCTAGAA 13 V_HSF1_Q6_01_M02017 TRANSFAC + 22988513 22988526 3.0E-06 GCAAATTCTAGAAA 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.