Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

TGIF2LX Entrez Description Chrom. Strand Promoter (Start - Stop) TSS Motifs 90316 TGFB-induced factor homeobox 2-like, X-linked chrX + 89171939 - 89177439 89176939 TGIF2LX_MEIS_full_dimeric_12_1 Transcription Factor Binding Sites   Download all TFBS in the TGIF2LX promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_SOX7_03_M02807 TRANSFAC + 89176825 89176846 4.0E-06 ACGCAAGAACAATGGGAAAAGA 22 V_HSF1_Q6_01_M02017 TRANSFAC - 89176813 89176826 4.0E-06 GTATTTTCTGTAAC 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.