Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

FBP2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 8789 fructose-1,6-bisphosphatase 2 chr9 - 97355575 - 97361075 97356075 Transcription Factor Binding Sites   Download all TFBS in the FBP2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints MGA_TBX_DBD_dimeric_18_2 SELEX - 97357353 97357370 9.0E-06 GGCGTGATGGCTCACGCC 18 Myf_MA0055.1 JASPAR + 97356156 97356167 1.0E-06 AAACAACTGCTG 12 V_MEQ_01_M02049 TRANSFAC + 97356142 97356150 4.0E-06 AAAACACAT 9 V_STAT5A_Q6_M01890 TRANSFAC + 97357454 97357466 7.0E-06 ACATTTCTCTGAA 13 V_MYF_01_M01302 TRANSFAC + 97356156 97356167 1.0E-06 AAACAACTGCTG 12 V_AP1_Q6_01_M00925 TRANSFAC + 97356149 97356157 2.0E-06 ATGACTCAA 9 V_STAT5A_02_M00460 TRANSFAC + 97357458 97357481 4.0E-06 TTCTCTGAAGGTCTTTTCCCCTGA 24 V_AP1_Q4_01_M00926 TRANSFAC - 97356149 97356156 1.0E-05 TGAGTCAT 8 V_FAC1_01_M00456 TRANSFAC + 97356138 97356151 5.0E-06 GCCCAAAACACATG 14 V_FRA1_Q5_M01267 TRANSFAC - 97356149 97356156 1.0E-05 TGAGTCAT 8

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.