Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

EDF1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 8721 endothelial differentiation-related factor 1 chr9 - 139760238 - 139765738 139760738 Transcription Factor Binding Sites   Download all TFBS in the EDF1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Ascl2_bHLH_DBD_dimeric_10_1 SELEX - 139760747 139760756 6.0E-06 AGCAGCTGCC 10 V_MEF2_02_M00231 TRANSFAC - 139761232 139761253 6.0E-06 TCCATCTCAAAAAATAAAAGTT 22 V_ASCL2_03_M02737 TRANSFAC - 139760743 139760759 1.0E-06 TCTAGCAGCTGCCGCTG 17 V_ASCL2_03_M02737 TRANSFAC + 139760744 139760760 7.0E-06 AGCGGCAGCTGCTAGAG 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.