Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

DNAH17 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 8632 dynein, axonemal, heavy chain 17 chr17 - 76572976 - 76578476 76573476 Transcription Factor Binding Sites   Download all TFBS in the DNAH17 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR - 76570252 76570270 7.0E-06 AGACCTCCAGGTGGTGCTC 19 SP3_C2H2_DBD_monomeric_11_1 SELEX - 76568531 76568541 1.0E-05 CCCACACCCCC 11 ZIC4_C2H2_DBD_monomeric_15_1 SELEX - 76568523 76568537 2.0E-06 CACCCCCCGCTGGGT 15 ZIC3_C2H2_full_monomeric_15_1 SELEX - 76568523 76568537 1.0E-06 CACCCCCCGCTGGGT 15 PRDM4_C2H2_full_monomeric_13_1 SELEX + 76577579 76577591 6.0E-06 TTACAAGGACCCC 13 ZIC1_C2H2_full_monomeric_14_1 SELEX - 76568524 76568537 2.0E-06 CACCCCCCGCTGGG 14 V_HSF1_Q6_M01023 TRANSFAC + 76570221 76570237 4.0E-06 ATGCTCGGGGCTTCTCA 17 V_RREB1_01_M00257 TRANSFAC - 76568529 76568542 5.0E-06 CCCCACACCCCCCG 14 V_LMO2COM_01_M00277 TRANSFAC - 76570255 76570266 9.0E-06 CTCCAGGTGGTG 12 V_CTCF_01_M01200 TRANSFAC - 76570252 76570271 8.0E-06 AAGACCTCCAGGTGGTGCTC 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.