Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

HORMAD1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 84072 HORMA domain containing 1 chr1 - 150692864 - 150698364 150693364 Transcription Factor Binding Sites   Download all TFBS in the HORMAD1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints SOX8_HMG_full_dimeric_17_1 SELEX + 150697103 150697119 6.0E-06 AATCATTTTCAGCGTTT 17 PRDM1_C2H2_full_monomeric-or-dimeric_15_1 SELEX - 150697008 150697022 2.0E-06 GTAAAGGGAAAGTTC 15 ZNF282_C2H2_DBD_monomeric_17_1 SELEX + 150697011 150697027 5.0E-06 CTTTCCCTTTACATTCA 17 SOX9_HMG_full_dimeric_17_1 SELEX + 150697103 150697119 7.0E-06 AATCATTTTCAGCGTTT 17 V_STAT_Q6_M00777 TRANSFAC - 150697003 150697015 6.0E-06 GAAAGTTCTTGGA 13 V_HNF1_Q6_M00790 TRANSFAC + 150697098 150697115 7.0E-06 AGCTTAATCATTTTCAGC 18 V_HNF1_Q6_01_M01011 TRANSFAC - 150697096 150697116 1.0E-06 CGCTGAAAATGATTAAGCTTA 21

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.