Search TFs
or Genes
Construction
and Validation
Optimal
Promoter Size
Download Citation and
Contact


EntrezDescriptionChrom.StrandPromoter
(Start - Stop)
TSS
8386 olfactory receptor, family 1, subfamily D, member 5 chr17 -2966401 - 2971901 2966901

Transcription Factor Binding Sites

 
Download all TFBS in the promoter
 
MotifSourceStrandStartStop PValueMatch
Sequence
Overlap w/
Footprints
SPIB_ETS_DBD_monomeric_14_1 SELEX + 2968730 2968743 4.0E-06 ATAAAGCAGAAGTG 14
SPI1_ETS_full_monomeric_14_1 SELEX + 2968730 2968743 4.0E-06 ATAAAGCAGAAGTG 14
ELF5_MA0136.1 JASPAR - 2968646 2968654 4.0E-06 TACTTCCTT 9
V_PU1_Q4_M01172 TRANSFAC - 2968642 2968660 5.0E-06 TATATTTACTTCCTTAAAC 19
V_CEBPB_01_M00109 TRANSFAC + 2968703 2968716 1.0E-06 ATGTTGTGCAATGG 14
V_SOX7_03_M02807 TRANSFAC - 2968755 2968776 1.0E-06 GAAGAAAAACAATAGTTGCTAA 22
V_HNF1_Q6_01_M01011 TRANSFAC + 2968719 2968739 1.0E-05 AGTAATGAACTATAAAGCAGA 21
V_ELF5_01_M01197 TRANSFAC + 2968644 2968654 1.0E-06 TTAAGGAAGTA 11
V_OCAB_Q6_M02113 TRANSFAC - 2968744 2968754 7.0E-06 ATATGCACAGC 11
V_ERR1_Q2_M00511 TRANSFAC + 2968623 2968636 9.0E-06 AGGGAAAGGTCATT 14
V_ELF5_04_M02241 TRANSFAC - 2968646 2968654 4.0E-06 TACTTCCTT 9
V_CEBP_Q2_01_M00912 TRANSFAC - 2968703 2968714 3.0E-06 ATTGCACAACAT 12
V_CEBPA_Q6_M01866 TRANSFAC + 2968703 2968715 3.0E-06 ATGTTGTGCAATG 13
Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns.
Developed at the Institute for Systems Biology in the Baliga Lab.
A Django site.   Powered by PostgreSQL