Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CWH43 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 80157 cell wall biogenesis 43 C-terminal homolog (S. cerevisiae) chr4 + 48983264 - 48988764 48988264 Transcription Factor Binding Sites   Download all TFBS in the CWH43 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints TBX1_TBX_DBD_dimeric_20_1 SELEX + 48991705 48991724 5.0E-06 TGCTGAGATTATAGGTGTGA 20 V_FOXO3A_Q1_M01137 TRANSFAC - 48991746 48991757 5.0E-06 TAAAAACAAGAG 12 V_RPC155_01_M01798 TRANSFAC - 48991659 48991674 0.0E+00 TCAGGAATTCGAGACC 16 V_ZFP105_03_M02827 TRANSFAC - 48991746 48991760 4.0E-06 TTTTAAAAACAAGAG 15 V_TAXCREB_02_M00115 TRANSFAC + 48988091 48988105 7.0E-06 GAGACGCATGTCCCC 15 V_FOXO1_Q5_M01216 TRANSFAC - 48991748 48991756 8.0E-06 AAAAACAAG 9 V_FOXL1_02_M02857 TRANSFAC + 48991752 48991767 1.0E-06 TTTTTAAAACAACTCA 16 V_TCF7_04_M02921 TRANSFAC - 48991749 48991763 1.0E-06 TTGTTTTAAAAACAA 15 V_ARP1_01_M00155 TRANSFAC + 48991664 48991679 9.0E-06 CGAATTCCTGAGCTCA 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.