Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ZNF208 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 7757 zinc finger protein 208 chr19 - 22193245 - 22198745 22193745 Transcription Factor Binding Sites   Download all TFBS in the ZNF208 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NFYA_MA0060.1 JASPAR - 22193816 22193831 8.0E-06 ATTATCCAATCAGGGA 16 VENTX_homeodomain_DBD_dimeric_21_1 SELEX + 22193817 22193837 5.0E-06 CCCTGATTGGATAATGTTTAA 21 Myf_MA0055.1 JASPAR - 22193777 22193788 6.0E-06 AGGCAGCTGGAG 12 V_NFY_C_M00209 TRANSFAC + 22193818 22193831 4.0E-06 CCTGATTGGATAAT 14 V_MYF_01_M01302 TRANSFAC - 22193777 22193788 6.0E-06 AGGCAGCTGGAG 12 V_CAAT_01_M00254 TRANSFAC - 22193820 22193831 3.0E-06 ATTATCCAATCA 12 V_ALPHACP1_01_M00687 TRANSFAC - 22193819 22193829 5.0E-06 TATCCAATCAG 11 V_NFY_01_M00287 TRANSFAC - 22193816 22193831 5.0E-06 ATTATCCAATCAGGGA 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.