Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 729355 TP53 target 3B chr16 + 33257119 - 33262619 33262119 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_OSR1_03_M02784 TRANSFAC - 33259486 33259501 8.0E-06 CATGACGGTAGCACTT 16 V_ERR3_Q2_01_M02094 TRANSFAC - 33259513 33259525 1.0E-06 ACACAAGGTCACT 13 V_DAX1_01_M01248 TRANSFAC - 33259509 33259528 1.0E-06 GAAACACAAGGTCACTGTTC 20 V_ESRRA_03_M02748 TRANSFAC - 33259510 33259526 8.0E-06 AACACAAGGTCACTGTT 17 V_ERR1_Q2_01_M02093 TRANSFAC - 33259512 33259522 3.0E-06 CAAGGTCACTG 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.