Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ZNF286B Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 729288 zinc finger protein 286B chr17 - 18585072 - 18590572 18585572 Transcription Factor Binding Sites   Download all TFBS in the ZNF286B promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints STAT1_MA0137.2 JASPAR + 18585627 18585641 4.0E-06 CAATTCCCAGAAGCG 15 V_STAT4_Q4_M01666 TRANSFAC + 18585630 18585643 8.0E-06 TTCCCAGAAGCGCC 14 V_STAT5A_02_M00460 TRANSFAC - 18585615 18585638 0.0E+00 TTCTGGGAATTGTAGTTCCGGGCG 24 V_STAT3_03_M01595 TRANSFAC - 18585625 18585640 4.0E-06 GCTTCTGGGAATTGTA 16 V_TCFAP2A_03_M02819 TRANSFAC + 18585225 18585239 8.0E-06 TGTCCCTGGGGGAAC 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.