Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 729092 chr10 + 75452554 - 75462554 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Hltf_MA0109.1 JASPAR - 75455291 75455300 1.0E-05 AAACTTATAC 10 V_RUSH1A_02_M01107 TRANSFAC - 75455291 75455300 1.0E-05 AAACTTATAC 10 V_FOXP1_01_M00987 TRANSFAC + 75455135 75455154 8.0E-06 TTATTTGTATTGGAAAGGGC 20 V_HNF3B_01_M00131 TRANSFAC + 75455131 75455145 1.0E-05 GGCCTTATTTGTATT 15 V_BCL6_01_M01183 TRANSFAC - 75455188 75455203 7.0E-06 TTTATTGTCATTCTTT 16 V_LDSPOLYA_B_M00317 TRANSFAC + 75455170 75455185 5.0E-06 AAACTGTGTTGTAATC 16 V_HNF3ALPHA_Q6_M00724 TRANSFAC + 75455136 75455146 6.0E-06 TATTTGTATTG 11 V_NKX22_01_M00485 TRANSFAC + 75455303 75455312 9.0E-06 ACAAGTACTT 10 V_NKX22_01_M00485 TRANSFAC - 75455305 75455314 3.0E-06 ATAAGTACTT 10 V_PBX_Q3_M00998 TRANSFAC - 75455253 75455264 1.0E-05 GATGGATGTTAC 12 V_LPOLYA_B_M00318 TRANSFAC + 75455197 75455204 7.0E-06 CAATAAAG 8 V_ZFP128_04_M02932 TRANSFAC - 75455290 75455303 2.0E-06 TGTAAACTTATACT 14 V_TCF11_01_M00285 TRANSFAC - 75455185 75455197 4.0E-06 GTCATTCTTTAGG 13

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.