Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 727957 maestro heat-like repeat family member 1 chr8 + 145197918 - 145203418 145202918 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_MUSCLE_INI_B_M00321 TRANSFAC - 145202685 145202705 8.0E-06 TTCGGCCGCCACGGCGCAGGC 21

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.