Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SOX10 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS Motifs 6663 SRY (sex determining region Y)-box 10 chr22 - 38380039 - 38385539 38380539 SOX10_HMG_full_dimeric_16_1 SOX10_HMG_full_dimeric_15_3 SOX10_HMG_full_dimeric_14_1 Transcription Factor Binding Sites   Download all TFBS in the SOX10 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 38379116 38379134 3.0E-06 CAACCACGAGGGGGCGCCT 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 38379117 38379133 2.0E-06 GGCGCCCCCTCGTGGTT 17 V_AP2_Q6_01_M00915 TRANSFAC + 38375967 38375979 3.0E-06 CCCTCCCCAGGCT 13 V_NFE4_Q5_M02105 TRANSFAC + 38375965 38375976 5.0E-06 CTCCCTCCCCAG 12 V_AHR_01_M00139 TRANSFAC - 38382585 38382602 2.0E-06 CTTCTGTCTAGCGTGGCT 18 V_CTCF_02_M01259 TRANSFAC + 38379113 38379132 1.0E-06 TTCCAACCACGAGGGGGCGC 20 V_CTCF_01_M01200 TRANSFAC + 38379115 38379134 2.0E-06 CCAACCACGAGGGGGCGCCT 20 V_DMRT7_01_M01151 TRANSFAC - 38379108 38379121 8.0E-06 TGGTTGGAATTTTG 14 V_ZABC1_01_M01306 TRANSFAC + 38379112 38379119 1.0E-05 ATTCCAAC 8

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.