Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

DEFB131 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 644414 defensin, beta 131 chr4 + 9441259 - 9446759 9446259 Transcription Factor Binding Sites   Download all TFBS in the DEFB131 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints znf143_MA0088.1 JASPAR + 9444221 9444240 4.0E-06 CCACCCCCAGAATGCAGTGA 20 V_SOX_Q6_M01014 TRANSFAC + 9444256 9444268 9.0E-06 TTCTTTGATATCC 13 V_IRF3_06_M02871 TRANSFAC - 9444237 9444250 4.0E-06 AGAGAAAGGTTCAC 14 V_STAF_02_M00264 TRANSFAC + 9444222 9444242 5.0E-06 CACCCCCAGAATGCAGTGAAC 21 V_ZBTB3_03_M02825 TRANSFAC - 9444228 9444244 1.0E-06 AGGTTCACTGCATTCTG 17 V_P53_05_M01655 TRANSFAC + 9449279 9449298 9.0E-06 AGGCCTGTCTTGGCTTGCAG 20 V_SRF_Q4_M00810 TRANSFAC - 9449313 9449330 1.0E-06 GCCATAAGAGGACATGGC 18 V_SRF_02_M01257 TRANSFAC - 9449314 9449331 8.0E-06 TGCCATAAGAGGACATGG 18

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.