Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PGA3 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 643834 chr11 + 60965983 - 60975983 0 Transcription Factor Binding Sites   Download all TFBS in the PGA3 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints RFX4_RFX_DBD_dimeric_16_1 SELEX + 60972172 60972187 4.0E-06 AGTTTCCAAGACAACA 16 RFX4_RFX_DBD_dimeric_16_1 SELEX - 60972172 60972187 7.0E-06 TGTTGTCTTGGAAACT 16 Rfx3_RFX_DBD_dimeric_16_1 SELEX + 60972172 60972187 8.0E-06 AGTTTCCAAGACAACA 16 Rfx3_RFX_DBD_dimeric_16_1 SELEX - 60972172 60972187 6.0E-06 TGTTGTCTTGGAAACT 16 RFX2_RFX_DBD_dimeric_16_1 SELEX + 60972172 60972187 5.0E-06 AGTTTCCAAGACAACA 16 RFX2_RFX_DBD_dimeric_16_1 SELEX - 60972172 60972187 5.0E-06 TGTTGTCTTGGAAACT 16 RFX5_RFX_DBD_dimeric_16_3 SELEX + 60972172 60972187 6.0E-06 AGTTTCCAAGACAACA 16 V_PAX5_01_M00143 TRANSFAC + 60972147 60972174 7.0E-06 CCTGGAGCCACGCAGGAAGAGCGGCAGT 28

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.