Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 643832 chrX + 49155124 - 49165124 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_ERR3_Q2_01_M02094 TRANSFAC + 49164455 49164467 5.0E-06 CTGCAAGGTCACT 13 V_DAX1_01_M01248 TRANSFAC + 49164452 49164471 3.0E-06 CAGCTGCAAGGTCACTAGAC 20 V_ESRRA_03_M02748 TRANSFAC + 49164454 49164470 5.0E-06 GCTGCAAGGTCACTAGA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.