Search TFs
or Genes
Construction
and Validation
Optimal
Promoter Size
Download Citation and
Contact

BTBD18


EntrezDescriptionChrom.StrandPromoter
(Start - Stop)
TSS
643376 BTB (POZ) domain containing 18 chr11 -57518753 - 57524253 57519253

Transcription Factor Binding Sites

 
Download all TFBS in the BTBD18 promoter
 
MotifSourceStrandStartStop PValueMatch
Sequence
Overlap w/
Footprints
CTCF_MA0139.1 JASPAR + 57519318 57519336 2.0E-06 TAACCAGCAGAGGGTGCAC 19
VENTX_homeodomain_DBD_dimeric_21_1 SELEX + 57519250 57519270 4.0E-06 CATTACTGGGTATAAAATTAT 21
Pou5f1_MA0142.1 JASPAR + 57516869 57516883 1.0E-06 CATTCATATGTAGAA 15
V_POU5F1_02_M02245 TRANSFAC + 57516869 57516883 1.0E-06 CATTCATATGTAGAA 15
V_ZBED6_01_M01598 TRANSFAC - 57519422 57519433 3.0E-06 CAGGCTCGCTTT 12
V_DOBOX4_01_M01359 TRANSFAC - 57519253 57519269 4.0E-06 TAATTTTATACCCAGTA 17
V_CTCF_02_M01259 TRANSFAC + 57519315 57519334 1.0E-06 CACTAACCAGCAGAGGGTGC 20
V_CTCF_01_M01200 TRANSFAC + 57519317 57519336 1.0E-06 CTAACCAGCAGAGGGTGCAC 20
V_SOX17_04_M02904 TRANSFAC + 57516864 57516880 4.0E-06 CAACTCATTCATATGTA 17
V_GATA3_02_M00350 TRANSFAC - 57519265 57519274 7.0E-06 AGAGATAATT 10
V_PIT1_Q6_M00802 TRANSFAC - 57519330 57519347 1.0E-05 TCTTCTTTATTGTGCACC 18
V_MEF2_01_M00006 TRANSFAC + 57519259 57519274 8.0E-06 GTATAAAATTATCTCT 16
V_LPOLYA_B_M00318 TRANSFAC + 57519336 57519343 7.0E-06 CAATAAAG 8
V_OCT4_01_M01125 TRANSFAC + 57516869 57516883 1.0E-06 CATTCATATGTAGAA 15
Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns.
Developed at the Institute for Systems Biology in the Baliga Lab.
A Django site.   Powered by PostgreSQL