Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

MS4A5 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 64232 membrane-spanning 4-domains, subfamily A, member 5 chr11 + 60192061 - 60197561 60197061 Transcription Factor Binding Sites   Download all TFBS in the MS4A5 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints LHX2_homeodomain_DBD_dimeric_15_1 SELEX + 60196152 60196166 6.0E-06 TAATTCATGTAATTG 15 LHX2_homeodomain_DBD_dimeric_15_1 SELEX - 60196152 60196166 2.0E-06 CAATTACATGAATTA 15 TBX1_TBX_DBD_dimeric_23_1 SELEX - 60196064 60196086 2.0E-06 TTTCAAACCTCTGCTGAGTCATG 23 MEOX2_homeodomain_DBD_dimeric_17_1 SELEX - 60196151 60196167 8.0E-06 CCAATTACATGAATTAG 17 Irx3_homeodomain_DBD_dimeric_12_1 SELEX - 60196152 60196163 5.0E-06 TTACATGAATTA 12 V_SOX8_04_M02912 TRANSFAC + 60196152 60196165 7.0E-06 TAATTCATGTAATT 14 V_SOX17_04_M02904 TRANSFAC + 60196148 60196164 1.0E-06 ATCCTAATTCATGTAAT 17 V_BBX_03_M02739 TRANSFAC + 60196152 60196166 1.0E-05 TAATTCATGTAATTG 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.