Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SAA4 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 6291 serum amyloid A4, constitutive chr11 - 18257884 - 18263384 18258384 Transcription Factor Binding Sites   Download all TFBS in the SAA4 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints TBX21_TBX_full_dimeric_16_1 SELEX + 18257219 18257234 1.0E-05 GGTGATAAATCAGACC 16 TBX21_TBX_full_dimeric_16_1 SELEX - 18257219 18257234 6.0E-06 GGTCTGATTTATCACC 16 EMX2_homeodomain_DBD_dimeric_14_1 SELEX + 18258713 18258726 9.0E-06 TTATTAGCAAAAGA 14 EBF1_MA0154.1 JASPAR + 18257208 18257217 5.0E-06 CCCCAAGGGA 10 V_HNF3A_01_M01261 TRANSFAC - 18258728 18258737 5.0E-06 AAGCAAACAT 10 V_MEF2_03_M00232 TRANSFAC - 18258705 18258726 5.0E-06 TCTTTTGCTAATAATATTGATC 22 V_EBF1_01_M02267 TRANSFAC + 18257208 18257217 5.0E-06 CCCCAAGGGA 10 V_T3R_Q6_M00963 TRANSFAC - 18258835 18258843 7.0E-06 CCTGTCCTT 9 V_GFI1B_01_M01058 TRANSFAC + 18257224 18257235 5.0E-06 TAAATCAGACCA 12 V_GLIS2_04_M02863 TRANSFAC + 18258712 18258725 9.0E-06 ATTATTAGCAAAAG 14 V_HOXB5_01_M01319 TRANSFAC - 18258809 18258824 8.0E-06 AGAATCATTACCTCAT 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.