Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 57663 chr19 + 57626508 - 57636508 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_REST_01_M01256 TRANSFAC - 57635441 57635462 3.0E-06 TTGGAGAGCTGTCCATGGTCAC 22 V_SOX15_04_M02903 TRANSFAC - 57635466 57635480 7.0E-06 TTTACTGAAGTTTAA 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.