Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

BEGAIN Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 57596 brain-enriched guanylate kinase-associated chr14 - 101033907 - 101041131 101034407 Transcription Factor Binding Sites   Download all TFBS in the BEGAIN promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints THRA_nuclearreceptor_FL_dimeric_18_1 SELEX - 101035921 101035938 9.0E-06 GTGTCCTGGTGAGAACAC 18 THRB_nuclearreceptor_DBD_dimeric_18_1 SELEX - 101035921 101035938 8.0E-06 GTGTCCTGGTGAGAACAC 18 V_COE1_Q6_M01871 TRANSFAC - 101037216 101037229 2.0E-06 CCTCAGGGGACTTG 14 V_ZFP281_05_M02935 TRANSFAC + 101033692 101033708 8.0E-06 GGGATTCCCCCAAAATG 17 V_AR_03_M00956 TRANSFAC + 101035907 101035933 1.0E-05 CGGGCAGGAGCCCTGTGTTCTCACCAG 27

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.