Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ZNF286A Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 57335 zinc finger protein 286A chr17 + 15597890 - 15603390 15602890 Transcription Factor Binding Sites   Download all TFBS in the ZNF286A promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints STAT1_MA0137.2 JASPAR - 15602967 15602981 4.0E-06 CAATTCCCAGAAGCG 15 NRF1_NRF_full_dimeric_12_1 SELEX + 15603028 15603039 1.0E-06 TACGCATGCGCG 12 NRF1_NRF_full_dimeric_12_1 SELEX - 15603028 15603039 1.0E-06 CGCGCATGCGTA 12 V_STAT4_Q4_M01666 TRANSFAC - 15602965 15602978 8.0E-06 TTCCCAGAAGCGCC 14 V_STAT5A_02_M00460 TRANSFAC + 15602970 15602993 0.0E+00 TTCTGGGAATTGTAGTTCCGGGCG 24 V_STAT3_03_M01595 TRANSFAC + 15602968 15602983 4.0E-06 GCTTCTGGGAATTGTA 16 V_ZFP206_01_M01742 TRANSFAC + 15603028 15603038 6.0E-06 TACGCATGCGC 11 V_ZFP206_01_M01742 TRANSFAC - 15603029 15603039 8.0E-06 CGCGCATGCGT 11 V_NRF1_Q6_M00652 TRANSFAC + 15603030 15603039 4.0E-06 CGCATGCGCG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.