Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

MUC13 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 56667 mucin 13, cell surface associated chr3 - 124653095 - 124658595 124653595 Transcription Factor Binding Sites   Download all TFBS in the MUC13 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Pax4_MA0068.1 JASPAR - 124653736 124653765 5.0E-06 AAAAATGATTCGTAAGGCCAGCTCCACCTC 30 V_GC_01_M00255 TRANSFAC + 124653734 124653747 8.0E-06 AAGAGGTGGAGCTG 14 V_AP1_01_M00517 TRANSFAC - 124653764 124653776 8.0E-06 CTTTGAGTCAGAA 13 V_PAX4_04_M00380 TRANSFAC - 124653736 124653765 6.0E-06 AAAAATGATTCGTAAGGCCAGCTCCACCTC 30

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.