Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

IRGC Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 56269 immunity-related GTPase family, cinema chr19 + 44215213 - 44220713 44220213 Transcription Factor Binding Sites   Download all TFBS in the IRGC promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints TCF4_bHLH_full_dimeric_10_1 SELEX - 44216350 44216359 3.0E-06 CACACCTGTA 10 TBX1_TBX_DBD_dimeric_20_1 SELEX + 44216341 44216360 9.0E-06 TGCTGGGATTACAGGTGTGA 20 V_PITX2_Q6_M02114 TRANSFAC - 44216344 44216353 1.0E-06 TGTAATCCCA 10 V_BARBIE_01_M00238 TRANSFAC - 44216420 44216434 9.0E-06 ATCAAAAGCTAGAAA 15 V_AP1_Q4_M00188 TRANSFAC - 44216356 44216366 1.0E-05 GGTGACTCACA 11 V_HNF1_Q6_01_M01011 TRANSFAC - 44216408 44216428 7.0E-06 AGCTAGAAATGATTAAGCTCA 21 V_JUNDM2_04_M02876 TRANSFAC + 44216353 44216368 4.0E-06 AGGTGTGAGTCACCAT 16 V_JUNDM2_04_M02876 TRANSFAC - 44216354 44216369 2.0E-06 CATGGTGACTCACACC 16 V_AP1_01_M00517 TRANSFAC + 44216355 44216367 9.0E-06 GTGTGAGTCACCA 13 V_AREB6_02_M00413 TRANSFAC - 44216349 44216360 6.0E-06 TCACACCTGTAA 12 V_GATA3_01_M00077 TRANSFAC - 44216376 44216384 4.0E-06 GAGATAGGG 9 V_PITX2_Q2_M00482 TRANSFAC - 44216343 44216353 1.0E-06 TGTAATCCCAG 11 V_TBX5_Q5_M01044 TRANSFAC - 44216352 44216361 3.0E-06 CTCACACCTG 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.