Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PROP1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS Motifs 5626 PROP paired-like homeobox 1 chr5 - 177422743 - 177428243 177423243 PROP1_homeodomain_full_dimeric_11_1 V_PROP1_01_M01294 V_PROP1_02_M01320 Transcription Factor Binding Sites   Download all TFBS in the PROP1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_STAT_Q6_M00777 TRANSFAC - 177425845 177425857 1.0E-05 GGCAGTTCTGGGA 13 V_STAT_Q6_M00777 TRANSFAC - 177425906 177425918 1.0E-05 GGCAGTTCTGGGA 13 V_STAT_Q6_M00777 TRANSFAC - 177425966 177425978 1.0E-05 GGCAGTTCTGGGA 13 V_STAT_Q6_M00777 TRANSFAC - 177426026 177426038 1.0E-05 GGCAGTTCTGGGA 13 V_CEBP_Q2_M00190 TRANSFAC + 177426363 177426376 9.0E-06 TGATTGCACAAGAA 14 V_ZFP410_03_M02832 TRANSFAC - 177425899 177425915 4.0E-06 AGTTCTGGGATGTGTAT 17 V_ZFP410_03_M02832 TRANSFAC - 177425959 177425975 4.0E-06 AGTTCTGGGATGTGTAT 17 V_ZFP410_03_M02832 TRANSFAC - 177426019 177426035 4.0E-06 AGTTCTGGGATGTGTAT 17 V_STAT5A_02_M00460 TRANSFAC - 177425829 177425852 1.0E-06 TTCTGGGAATGTGTATTCTACAGA 24 V_CEBPA_01_M00116 TRANSFAC + 177426363 177426376 8.0E-06 TGATTGCACAAGAA 14 V_MEIS1_01_M00419 TRANSFAC + 177426394 177426405 4.0E-06 CCATGACAGATC 12 V_P53_01_M00034 TRANSFAC - 177425849 177425868 9.0E-06 GAAGATGTCCTGGCAGTTCT 20 V_CEBP_Q2_01_M00912 TRANSFAC + 177426365 177426376 9.0E-06 ATTGCACAAGAA 12 V_CEBPA_Q6_M01866 TRANSFAC - 177426364 177426376 7.0E-06 TTCTTGTGCAATC 13

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.