Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PCDHB13 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 56123 protocadherin beta 13 chr5 + 140588508 - 140594008 140593508 Transcription Factor Binding Sites   Download all TFBS in the PCDHB13 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints Pax4_MA0068.1 JASPAR - 140593388 140593417 3.0E-06 GAATGATAATGGATGTAATATTCCCAACTC 30 V_CP2_01_M00072 TRANSFAC + 140593470 140593480 2.0E-06 GCACAAACCAG 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.