Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 5555 chr12 + 11076833 - 11086834 0 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints MZF1_5-13_MA0057.1 JASPAR - 11086823 11086832 8.0E-06 CTAGGGGGAA 10 V_CTCF_02_M01259 TRANSFAC - 11086822 11086841 1.0E-05 AATACATCACTAGGGGGAAC 13

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.