Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

TRPV6 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 55503 transient receptor potential cation channel, subfamily V, member 6 chr7 - 142582990 - 142588490 142583490 Transcription Factor Binding Sites   Download all TFBS in the TRPV6 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 142578830 142578848 4.0E-06 TGCCCACAAGGGGACAGCA 19 V_LYF1_01_M00141 TRANSFAC - 142583565 142583573 9.0E-06 TTTGGGAGG 9 V_CDX_Q5_M00991 TRANSFAC + 142583572 142583589 5.0E-06 AATTACCTGAGATTTAAA 18 V_HOX13_01_M00023 TRANSFAC + 142583560 142583589 9.0E-06 TCCCTCCTCCCAAATTACCTGAGATTTAAA 30 V_LUN1_01_M00480 TRANSFAC - 142583567 142583583 0.0E+00 TCTCAGGTAATTTGGGA 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.