Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

SBNO1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 55206 strawberry notch homolog 1 (Drosophila) chr12 - 123834488 - 123839988 123834988 Transcription Factor Binding Sites   Download all TFBS in the SBNO1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints SPIB_ETS_DBD_monomeric_14_1 SELEX + 123831704 123831717 2.0E-06 AAAAAGCAGAACTA 14 ZNF282_C2H2_DBD_monomeric_17_1 SELEX - 123831683 123831699 5.0E-06 CTTTCCCAATATCCTAC 17 SPI1_ETS_full_monomeric_14_1 SELEX + 123831704 123831717 1.0E-06 AAAAAGCAGAACTA 14 V_PU1_Q4_M01172 TRANSFAC - 123831705 123831723 8.0E-06 TCTCTCTAGTTCTGCTTTT 19 V_CEBPB_02_M00117 TRANSFAC + 123836111 123836124 0.0E+00 TGATTGCACAACTG 14 V_LUN1_01_M00480 TRANSFAC + 123836055 123836071 3.0E-06 TCCCAGCTACTTGGGAG 17 V_MYOGNF1_01_M00056 TRANSFAC - 123831689 123831717 3.0E-06 TAGTTCTGCTTTTTGCCGCTTTCCCAATA 29 V_CEBPB_Q6_M01896 TRANSFAC - 123836112 123836121 2.0E-06 TTGTGCAATC 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.