Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ROPN1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 54763 rhophilin associated tail protein 1 chr3 - 123709699 - 123715199 123710199 Transcription Factor Binding Sites   Download all TFBS in the ROPN1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ELK1_MA0028.1 JASPAR - 123711838 123711847 5.0E-06 AAACCGGAAG 10 PPARG_MA0066.1 JASPAR + 123711807 123711826 6.0E-06 GTAGGGCTCAGGGCCCAACT 20 V_ZBTB4_04_M02929 TRANSFAC - 123711780 123711795 5.0E-06 CGATCACAGGCAAAAT 16 V_NRF2_01_M00108 TRANSFAC - 123711836 123711845 3.0E-06 ACCGGAAGAC 10

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.