Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

NECAB2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 54550 N-terminal EF-hand calcium binding protein 2 chr16 + 83997236 - 84002736 84002236 Transcription Factor Binding Sites   Download all TFBS in the NECAB2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 84001802 84001820 7.0E-06 GAGCCGGCAGAGGGCGCTC 19 HINFP1_C2H2_full_dimeric_19_1 SELEX - 84001755 84001773 1.0E-05 GCGGCCCCGTCACGCCCGC 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 84001803 84001819 3.0E-06 AGCGCCCTCTGCCGGCT 17 V_KROX_Q6_M00982 TRANSFAC - 84001774 84001787 4.0E-06 GGCGCCCACGCCCC 14 V_CTCF_01_M01200 TRANSFAC + 84001801 84001820 1.0E-06 GGAGCCGGCAGAGGGCGCTC 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.