Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

CT45A1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 541466 cancer/testis antigen family 45, member A1 chrX + 134842184 - 134847684 134847184 Transcription Factor Binding Sites   Download all TFBS in the CT45A1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints CTCF_MA0139.1 JASPAR + 134847082 134847100 0.0E+00 TCGCCTGTAGAGGGCGCCA 19 CTCF_C2H2_full_monomeric_17_1 SELEX - 134847083 134847099 9.0E-06 GGCGCCCTCTACAGGCG 17 V_CTCF_02_M01259 TRANSFAC + 134847079 134847098 1.0E-06 AGGTCGCCTGTAGAGGGCGC 20 V_CTCF_01_M01200 TRANSFAC + 134847081 134847100 0.0E+00 GTCGCCTGTAGAGGGCGCCA 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.