Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

MYO3A Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 53904 myosin IIIA chr10 + 26218001 - 26223501 26223001 Transcription Factor Binding Sites   Download all TFBS in the MYO3A promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_STAT5A_Q6_M01890 TRANSFAC + 26224025 26224037 1.0E-06 TGATTTCTCAGAA 13 V_STAT5B_01_M00459 TRANSFAC + 26224026 26224040 7.0E-06 GATTTCTCAGAACAA 15 V_STAT4_Q4_M01666 TRANSFAC - 26224024 26224037 8.0E-06 TTCTGAGAAATCAC 14 V_OLF1_01_M00261 TRANSFAC - 26223996 26224017 9.0E-06 CGCAGTTCCCTCAGGGACGGGC 22 V_SREBP_Q6_M01168 TRANSFAC - 26223449 26223463 4.0E-06 TCTCTCACCCCAGGC 15 V_STAT4_Q5_M02117 TRANSFAC - 26224028 26224037 5.0E-06 TTCTGAGAAA 10 V_STAT1STAT1_Q3_M01212 TRANSFAC + 26224027 26224039 3.0E-06 ATTTCTCAGAACA 13 V_SREBP1_Q5_M01173 TRANSFAC - 26223449 26223463 4.0E-06 TCTCTCACCCCAGGC 15

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.