Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PMP2 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 5375 peripheral myelin protein 2 chr8 - 82359219 - 82364719 82359719 Transcription Factor Binding Sites   Download all TFBS in the PMP2 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints PRDM4_C2H2_full_monomeric_13_1 SELEX + 82359701 82359713 7.0E-06 TTTCAAGGATGCC 13 V_PAX5_01_M00143 TRANSFAC - 82359692 82359719 9.0E-06 GCTTTGGGCATCCTTGAAAAGAATCTTC 28

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.