Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PGM5 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 5239 phosphoglucomutase 5 chr9 + 70966814 - 70972314 70971814 Transcription Factor Binding Sites   Download all TFBS in the PGM5 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints IRF7_IRF_DBD_dimeric_14_1 SELEX + 70971497 70971510 8.0E-06 TCTAAAGAGAAACT 14 Stat3_MA0144.1 JASPAR + 70971810 70971819 9.0E-06 TTACAGGAAG 10 RREB1_MA0073.1 JASPAR + 70971347 70971366 3.0E-06 ACACACCCCACACGCAGCGC 20 V_BCL6_01_M01183 TRANSFAC - 70971804 70971819 3.0E-06 CTTCCTGTAAAGTTTT 16 V_AP2_Q6_01_M00915 TRANSFAC + 70971879 70971891 2.0E-06 CGGTCCCCAGGCG 13 V_ISRE_01_M00258 TRANSFAC - 70971497 70971511 1.0E-05 CAGTTTCTCTTTAGA 15 V_ICSBP_Q6_M00699 TRANSFAC + 70971500 70971511 0.0E+00 AAAGAGAAACTG 12 V_IRF1_Q6_01_M01881 TRANSFAC - 70971498 70971511 5.0E-06 CAGTTTCTCTTTAG 14 V_SRY_05_M02917 TRANSFAC + 70970652 70970668 8.0E-06 TAAGTGGACAATATTTG 17 V_STAT1_05_M01260 TRANSFAC + 70971807 70971828 7.0E-06 ACTTTACAGGAAGGCAGAAGCA 22

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.