Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

BPIFA1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 51297 BPI fold containing family A, member 1 chr20 + 31818801 - 31824301 31823801 Transcription Factor Binding Sites   Download all TFBS in the BPIFA1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_CTCF_02_M01259 TRANSFAC + 31821136 31821155 6.0E-06 CCAGAGCCAGAAGAGGGCAT 20

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.