Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PRLH Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 51052 prolactin releasing hormone chr2 + 238470216 - 238475716 238475216 Transcription Factor Binding Sites   Download all TFBS in the PRLH promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ESR1_MA0112.2 JASPAR + 238472610 238472629 1.0E-06 ATCCAAAGCCACCCTGCCCT 20 FEV_MA0156.1 JASPAR + 238472704 238472711 1.0E-05 CAGGAAAT 8 REST_MA0138.2 JASPAR - 238472649 238472669 0.0E+00 GTCTCCACCATGGACAGCGCC 21 V_NRSF_Q4_M01028 TRANSFAC + 238472650 238472668 1.0E-06 GCGCTGTCCATGGTGGAGA 19 V_ESR1_01_M02261 TRANSFAC + 238472610 238472629 1.0E-06 ATCCAAAGCCACCCTGCCCT 20 V_REST_01_M01256 TRANSFAC + 238472645 238472666 0.0E+00 CTCCGGCGCTGTCCATGGTGGA 22 V_NRSF_01_M00256 TRANSFAC - 238472649 238472669 2.0E-06 GTCTCCACCATGGACAGCGCC 21 V_REST_02_M02256 TRANSFAC - 238472649 238472669 0.0E+00 GTCTCCACCATGGACAGCGCC 21 V_FEV_01_M02269 TRANSFAC + 238472704 238472711 1.0E-05 CAGGAAAT 8

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.