Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

PAK3 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 5063 p21 protein (Cdc42/Rac)-activated kinase 3 chrX + 110182512 - 110188012 110187512 Transcription Factor Binding Sites   Download all TFBS in the PAK3 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints ESRRG_nuclearreceptor_full_dimeric_17_1 SELEX - 110188518 110188534 4.0E-06 AATGAGACCCAAGGACA 17 V_DEC2_Q2_M01843 TRANSFAC - 110187582 110187591 9.0E-06 GCTCACGTGC 10 V_HEN1_01_M00068 TRANSFAC - 110187575 110187596 4.0E-06 TGCGGGCTCACGTGCGCCCCAT 22 V_GM497_04_M02864 TRANSFAC - 110188459 110188474 5.0E-06 ACACGCACACACACAC 16 V_GM497_04_M02864 TRANSFAC - 110188467 110188482 4.0E-06 ACACACACACACGCAC 16 V_FKLF_Q5_M01837 TRANSFAC - 110188087 110188096 5.0E-06 GGGGTGGGCG 10 V_FOXK1_04_M02856 TRANSFAC + 110188242 110188256 8.0E-06 CATACAACAAAACCA 15 V_ASCL2_03_M02737 TRANSFAC + 110187633 110187649 0.0E+00 CTCAGCAGCTGCCACCG 17 V_FAC1_01_M00456 TRANSFAC - 110188408 110188421 8.0E-06 ACACAAAACCCACA 14 V_ZBTB4_04_M02929 TRANSFAC + 110187512 110187527 3.0E-06 TAATCACAGTCAAAAT 16

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.