Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

OR1F1 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 4992 chr16 + 3249246 - 3259246 0 Transcription Factor Binding Sites   Download all TFBS in the OR1F1 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints MEF2D_MADS_DBD_dimeric_12_1 SELEX + 3256114 3256125 8.0E-06 TCTATAAATGGC 12 V_CEBPG_Q6_M00622 TRANSFAC - 3257382 3257394 6.0E-06 CTGATGTCAAAGA 13 V_MMEF2_Q6_M00405 TRANSFAC + 3256111 3256126 6.0E-06 AGGTCTATAAATGGCT 16 V_REX1_01_M01695 TRANSFAC - 3256119 3256128 4.0E-06 GCAGCCATTT 10 V_SP1_01_M00008 TRANSFAC + 3257358 3257367 7.0E-06 GGGGCAGGGT 10 V_SRF_03_M01304 TRANSFAC + 3256113 3256125 8.0E-06 GTCTATAAATGGC 13 V_PPARG_02_M00515 TRANSFAC - 3257354 3257376 7.0E-06 CTCTGGCTGACCCTGCCCCCTAA 23

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.