Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

NMBR Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 4829 neuromedin B receptor chr6 - 142409436 - 142414936 142409936 Transcription Factor Binding Sites   Download all TFBS in the NMBR promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints EBF1_EBF_full_dimeric_14_1 SELEX - 142410140 142410153 2.0E-06 ATCCCCAAGGGACA 14 EBF1_MA0154.1 JASPAR - 142410142 142410151 5.0E-06 CCCCAAGGGA 10 NFATC1_NFAT_full_dimeric_20_1 SELEX + 142410109 142410128 3.0E-06 AGCGGAAAACAGCCTTTCAG 20 V_EBF_Q6_M00977 TRANSFAC + 142410141 142410151 1.0E-05 GTCCCTTGGGG 11 V_AP4_Q6_02_M01860 TRANSFAC - 142410217 142410229 5.0E-06 TCAGCTGCGGCCC 13 V_REST_01_M01256 TRANSFAC + 142410200 142410221 9.0E-06 TCCTGGCGCTGTCCAGCGGGCC 22 V_EBF1_01_M02267 TRANSFAC - 142410142 142410151 5.0E-06 CCCCAAGGGA 10 V_LMO2COM_01_M00277 TRANSFAC - 142410160 142410171 6.0E-06 CGGCAGGTGCTT 12

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.