Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

ARHGEF35 Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 445328 Rho guanine nucleotide exchange factor (GEF) 35 chr7 - 143892291 - 143897791 143892791 Transcription Factor Binding Sites   Download all TFBS in the ARHGEF35 promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints NFYA_MA0060.1 JASPAR - 143894273 143894288 4.0E-06 AACAGCCAATGGGCAC 16 V_COMP1_01_M00057 TRANSFAC - 143894278 143894301 1.0E-06 CAGGATCATTGGCAACAGCCAATG 24 V_RFX_Q6_M00975 TRANSFAC + 143894284 143894292 4.0E-06 CTGTTGCCA 9 V_NFY_01_M00287 TRANSFAC - 143894273 143894288 5.0E-06 AACAGCCAATGGGCAC 16 V_NFYA_Q5_M02106 TRANSFAC - 143894273 143894286 3.0E-06 CAGCCAATGGGCAC 14

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.