Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 442590 speedy/RINGO cell cycle regulator family member E5 chr7 + 75119298 - 75124798 75124298 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints RUNX3_RUNX_full_monomeric_10_1 SELEX + 75120156 75120165 7.0E-06 AAACCACAAC 10 RUNX2_RUNX_DBD_monomeric_9_1 SELEX + 75120156 75120164 8.0E-06 AAACCACAA 9 RUNX1_MA0002.2 JASPAR - 75120156 75120166 8.0E-06 AGTTGTGGTTT 11 REST_MA0138.2 JASPAR - 75120137 75120157 8.0E-06 TTCTGTACCTTGAAGAGAACT 21 V_AML3_Q6_M01856 TRANSFAC + 75120157 75120164 1.0E-05 AACCACAA 8 V_RUNX1_01_M02257 TRANSFAC - 75120156 75120166 8.0E-06 AGTTGTGGTTT 11 V_AML2_01_M01759 TRANSFAC + 75120157 75120164 1.0E-05 AACCACAA 8 V_REST_02_M02256 TRANSFAC - 75120137 75120157 8.0E-06 TTCTGTACCTTGAAGAGAACT 21 V_COREBINDINGFACTOR_Q6_M00722 TRANSFAC - 75120156 75120163 1.0E-05 TGTGGTTT 8

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.