Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 441155 zinc finger CCCH-type domain-containing-like chr6 + 66006310 - 66011810 66011310 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints MSX2_homeodomain_DBD_dimeric_18_1 SELEX - 66009325 66009342 7.0E-06 GCCATTAGAAAGCAATAG 18 SOX9_HMG_DBD_monomeric_9_1 SELEX - 66009342 66009350 9.0E-06 AAACAATGG 9 Msx3_homeodomain_DBD_dimeric_18_1 SELEX - 66009325 66009342 5.0E-06 GCCATTAGAAAGCAATAG 18 SOX9_MA0077.1 JASPAR - 66009342 66009350 2.0E-06 AAACAATGG 9 MSX1_homeodomain_DBD_dimeric_18_1 SELEX - 66009325 66009342 4.0E-06 GCCATTAGAAAGCAATAG 18 RREB1_MA0073.1 JASPAR + 66009298 66009317 3.0E-06 ACCCCCCCCAAAAAACAACT 20 V_SOX14_05_M02902 TRANSFAC - 66009339 66009353 9.0E-06 TTCAAACAATGGCCA 15 V_ZFP740_03_M02834 TRANSFAC + 66009296 66009311 8.0E-06 TGACCCCCCCCAAAAA 16 V_FOXO3A_Q1_M01137 TRANSFAC + 66009307 66009318 5.0E-06 AAAAAACAACTT 12 V_ZBTB7B_03_M02826 TRANSFAC + 66009297 66009311 8.0E-06 GACCCCCCCCAAAAA 15 V_ZBTB7B_03_M02826 TRANSFAC + 66009298 66009312 5.0E-06 ACCCCCCCCAAAAAA 15 V_RREB1_01_M00257 TRANSFAC + 66009303 66009316 1.0E-06 CCCCAAAAAACAAC 14 V_FOXO1_Q5_M01216 TRANSFAC + 66009308 66009316 5.0E-06 AAAAACAAC 9 V_FOXO4_01_M00472 TRANSFAC + 66009308 66009318 6.0E-06 AAAAACAACTT 11

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.