Search TFs or Genes

Construction and Validation

Optimal Promoter Size

Download

Citation and Contact

Entrez Description Chrom. Strand Promoter (Start - Stop) TSS 401447 ubiquitin specific peptidase 17-like family member 1, pseudogene chr8 + 7184908 - 7190408 7189908 Transcription Factor Binding Sites   Download all TFBS in the promoter   Motif Source Strand Start Stop PValue Match Sequence Overlap w/ Footprints V_FOXP1_01_M00987 TRANSFAC + 7186431 7186450 7.0E-06 ATATTTCTCTTTTCTTGCAG 20 V_BCL6_Q3_01_M02085 TRANSFAC - 7186500 7186509 3.0E-06 CTTTCAAGAA 10 V_LHX2_01_M01325 TRANSFAC - 7186467 7186483 1.0E-05 GAGACTAATTGATGACA 17 V_HB24_01_M01399 TRANSFAC - 7186467 7186481 1.0E-05 GACTAATTGATGACA 15 V_LHX9_01_M01367 TRANSFAC + 7186468 7186484 6.0E-06 GTCATCAATTAGTCTCT 17

Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns. Developed at the Institute for Systems Biology in the Baliga Lab.