Search TFs
or Genes		 Construction
and Validation		 Optimal
Promoter Size		 Download Citation and
Contact

TMPRSS11BNL


EntrezDescriptionChrom.StrandPromoter
(Start - Stop)		TSS
401136 TMPRSS11B N-terminal like chr4 -69083298 - 69088798 69083798

Transcription Factor Binding Sites

 
Download all TFBS in the TMPRSS11BNL promoter
 
MotifSourceStrandStartStop PValueMatch
Sequence		Overlap w/
Footprints
V_FOXP1_01_M00987 TRANSFAC + 69083901 69083920 4.0E-06 TTACTTGGATTGGTGTTCTG 20
V_AP1_Q2_01_M00924 TRANSFAC + 69083968 69083979 9.0E-06 TGACTCAAGTTC 12
Need help? Please contact cplaisier(at)systemsbiology.org if you have any questions, comments or concerns.
Developed at the Institute for Systems Biology in the Baliga Lab.
A Django site.   Powered by PostgreSQL